Skip to main content

Table 1 Oligonucleotide primers for PCR amplification

From: Minimal invasive annulotomy for induction of disc degeneration and implantation of poly (lactic-co-glycolic acid) (PLGA) plugs for annular repair in a rabbit model

Gene Primer sequence (5′–3′) Annealing temperature (°C)
GAPDH Forward: ACTCTGGCAAAGTGGATG
Reverse: TCCTGGAAGATGGTGATG
60
Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT
Reverse: GTGTGGATGGGGTACCTGAC
62
COL1A1 Forward: AGGGCCAAGACGAAGACATC
Reverse: AGATCACGTCATCGCACAACA
60
COL2A1 Forward: GGATAGACCCCAACCAAGGC
Reverse: GCTGCTCCACCAGTTCTTCT
62
MMP-3 Forward: GCCAAGAGATGCTGTTGATG
Reverse: AGGTCTGTGAAGGCGTTGTA
65