Skip to main content

Table 1 Primer sequence of quantitative real-time polymerase chain reaction (qRT-PCR)

From: Diagnostic value of microRNA-143 in predicting in-stent restenosis for patients with lower extremity arterial occlusive disease

Primer Sequence (5′–3′) Length (bp)
U6 Forward: GTTTTGTAGTTTTTGGAGTTAGTGTTGTGT 135
Reverse: CTCAACCTACAATCAAAAACAACACAAACA
miR-143 Forward: TGTAGTTTTCGGAGTTAGTGTCGCGC 556
Reverse: CCTACGATCGAAAACGACGCGAACG