Skip to main content

Table 1 Primer sequence

From: miR-34a targets PAI-1 to regulate urinary microalbumin and renal function in hypertensive mice

GenePrimer sequence (5′–3′)
miR-34aForward: GGGTGGCAGTGTCTTAGCT
Reverse: GTGCAGGGTCCGAGGT
U6Forward: TCTGTGGAACCCTCCACTCT
Reverse: GCTTAGGATGCTGCTCCNO
PAI-1Forward: CAAGCTCTTCCAGACTATGGTG
Reverse: ACCTTTGGTATGCCTTTCCAC
GAPDHForward: TGACCTCAACTANOGGTCTACA
Reverse: CTTCCNOTCTCGGCCTTG