Skip to main content

Table 1 Primers used in this study

From: Effect of glutathione-stabilized silver nanoparticles on expression of las I and las R of the genes in Pseudomonas aeruginosa strains

Target gene Sequence primer (5′→3′) Amplicon size (bp) Annealing temperature References
las R F AAGTGGAAAATTGGAGTGGAG 130 60 °C [16]
R GTAGTTGCCGACGACGATGAAG
las I F CGTGCTCAAGTGTTCAAGG 294 60 °C [17]
R TACAGTCGGAAAAGCCCAG
16 s rRNA F GGGGGATCTTCGGACCTCA 956 57 °C [18]
R TCCTTAGAGTGCCCACCCG