Skip to main content

Table 1 Primer sequences

From: Electroacupuncture pretreatment alleviates myocardial injury through regulating mitochondrial function

Genes Forward Reverse
GAPDH AATGGTGAAGGTCGGTGTGAAC AGGTCAATGAAGGGGTCGTTG
Bcl-2 ATGATAACCGGAGATCGTG GACGGTAGCGACGAGAGAAG
VDAC1 CACCAAAGTGAACGGCAGTC TGCTCCCTCTTGTACCCTGT
UCP2 GCCAACCTCATGACAGACGA AGGAAGGCATGAACCCCTTG
PGC-1α CATGTGCAGCCAAGACTCTG GTGAGGACCGCTAGCAAGTT
NRF1 GCTAATGGCCCAGATATGGAGT CGTAAGCTCTGCCTGGTTGT
mtTFA GGAATCAAGACTGTGCGTGC AGAAACTGCAATGGCTCTGC
ANT1 GCTAACCAACCCACTGTCCT ATGCCACCGCTAACAAGACAT