Skip to main content

Table 1 Primers used in this study

From: Prevalence and distribution of resistance and enterotoxins/enterotoxin-like genes in different clinical isolates of coagulase-negative Staphylococcus

Gene targets Primer sequences (5′ to 3′) Amplicon size (bp) References
sea F: TTGGAAACGGTTAAAACGAA
R: GAACCTTCCCATCAAAAACA
120 [22]
seb F: TCGCATCAAACTGACAAACG
R: GCAGGTACTCTATAAGTGCC
478 [22]
sec F: GACATAAAAGCTAGGAATTT
R: AAATCGGATTAACATTATCC
257 [22]
sed F: CTAGTTTGGTAATATCTCCT
R: TAATGCTATATCTTATAGGG
317 [22]
see F: TAGATAAAGTTAAAACAAGC
R: TAACTTACCGTGGACCCTTC
170 [22]
seg F: TGCTATCGACACACTACAACC
R: CCAGATTCAAATGCAGAACC
704 [22]
seh F: CGAAAGCAGAAGATTTACACG
R: GACCTTTACTTATTTCGCTGTC
495 [22]
sei F: GACAACAAAACTGTCGAAACTG
R: CCATATTCTTTGCCTTTACCAG
630 [22]
selj F: CAGCGATAGCAAAAATGAAACA
R: TCTAGCGGAACAACAGTTCTGA
426 [22]
selm F: CCAATTGAAGACCACCAAAG
R: CTTGTCCTGTTCCAGTATCA
517 [22]
seln F: ATTGTTCTACATAGCTGCAA
R: TTGAAAAAACTCTGCTCCCA
682 [22]
selo F: AGTCAAGTGTAGACCCTATT
R: TATGCTCCGAATGAGAATGA
534 [22]
selk F: TAGGTGTCTCTAATAATGCCA
R: TAGATATTCGTTAGTAGCTG
293 [23]
sell F: TAACGGCGATGTAGGTCCAGG
R: CATCTATTTCTTGTGCGGTAAC
383 [23]
selp F: TGATTTATTAGTAGACCTTGG
R: ATAACCAACCGAATCACCAG
396 [23]
selr F: GGATAAAGCGGTAATAGCAG
R: GTATTCCAAACACATCTAAC
166 [23]
selu F: AATGGCTCTAAAATTGATGG
R: ATTTGATTTCCATCATGCTC
215 [24]
selq F: GGAAAATACACTTTATATTCACAGTTTCA
R: ATTTATTCAGTTTTCTCATATGAAATCTC
539 [24]
tsst F: AAGCCCTTTGTTGCTTGCG
R: ATCGAACTTTGGCCCATACTTT
447 [23]