Skip to main content

Table 1 Primer, sequences, and protocols for quantitative real-time polymerase chain reaction

From: Fibroblast-like cells change gene expression of bone remodelling markers in transwell cultures

Primer Sequenzen (5′-3′) Primer concentration (nM) Amplification Efficiency (E = 10−1/slope)
ALP TCAAGGGTCAGCTCCACCACA
ATTGGCCTTCACCCCACACA
300 95 °C 10 s, 60 °C 10 s, 72 °C 30 s for 45 cycles 2.01
Collagen 1A1 GCTTCCCTGGTCTTCCTG
TCTCACCACGGTCACCCT
500 95 °C 10 s, 65 °C 10 s, 72 °C 15 s for 40 cycles 2.01
GAPDH TGCACCACCAACTGCTTAGC
GGCATGGACTGTGGTCATGAG
300 95 °C 10 s, 60 °C 10 s, 72 °C 15 s for 40 cycles 2.04
Cathepsin K TTCCCGCAGTAATGACACC
TTTCCCCAGTTTTCTCCCC
500 95 °C 10 s, 63 °C 10 s, 72 °C 20 s for 40 cycles 1.83
M-CSF CCGAGGAGGTGTCGGAGTAC
AATTTGGCACGAGGTCTCCAT
300 95 °C 10 s, 60 °C 10 s, 72 °C 15 s for 40 cycles 2.01
MMP 13 GACTTCACGATGGCATTGCTG
GCATCAACCTGCTGAGGATGC
300 95 °C 10 s, 62 °C 10 s, 72 °C 20 s for 40 cycles 1.90
OPG CTGCGCGCTCGTGTTTC
ACAGCTGATGAGAGGTTTCTTCGT
300 95 °C 30 s, 60 °C 60 s, 72 °C 15 s for 40 cycles 1.99
RANK-L CATCCCATCTGGTTCCCATAA
GCCCAACCCCGATCATG
300 95 °C 10 s, 60 °C 10 s, 72 °C 15 s for 40 cycles 2.07
TNF α CCCAGGGACCTCTCTCTAATC
GCTTGAGGGTTTGCTACAACATG
300 95 °C 30 s, 60 °C 60 s, 72 °C 15 s for 40 cycles 1.97