Skip to main content

Table 1 Primers used for PCR

From: Microbiological safety of a novel bio-artificial liver support system based on porcine hepatocytes: a experimental study

Name Direction Sequence 5′→3′
Protease-specific Forward GCTACAACCATTAGGAAAACTAAAAG
  Reverse AACCAGGACTGTATATCTTGATCAG
Polymerase-specific Forward CTACAACCATTAGGAAAACTAAAAG
  Reverse AACCAGGACTGTATATCTTGATCAG
SsCytB Forward CATTGGAGTAGTCCTACTATTTACCG
  Reverse GTAGGATTAGTATTATAAATAAGGCTCCT
β-actin Forward GCTCGTCGTCGACAACGGCTC
  Reverse CAAACATGATCTGGGTCATCTTCTC
  1. SsCytB, Sus scrofa cytochrome B.