Skip to main content

Table 1 Sequences of PCR primers, amplicon sizes, temperatures and GC content in SNPs of ZBTB17, HSPB7 , and ACTC1 in DCM patients and control subjects

From: Polymorphism of ZBTB17 gene is associated with idiopathic dilated cardiomyopathy: a case control study in a Han Chinese population

Markers Forward primer (5-3) Reverse primer (5-3) Amplicon size (bp) Temperature (°C) GC (%)
ZBTB17      
rs10927875 GCCAGAGTGGATGATCACTG TTCTGTTTCCACCACTGTAG 91 54.2 55
HSPB7      
rs1739843 TGTCCTCACTCTGCCATCAC TGGGCAGAGGGAGCCTGAG 99 50.8 50
rs7523558 GCCCAGCACCTATTTATAGC CTCATAGGCCAGTGATGAAG 94 46.6 35
rs6660685 TACTGTCCCACAGCCAGCAC TCTTCTCAGCCTCCTGGTG 98 50.8 58.8
ACTC1      
rs533021 GGCCTTCCATTTGAATATGC GTATGAGAGCACATTTTCTG 96 45.1 33.3
rs589759 CTTCTCACCTCCCTAATTCC TGTGGCCTGGAGGCTTTAAG 96 49.4 45
rs1370154 GCAGCAACTCATTCTAGAG TTTCATACCTGAAAAGCAG 108 45.2 24
rs2070664 CATAACAATGACTGCTGCAC ATAGCTTGTGGAGATAGGTC 100 46.9 60
rs3759834 TCTCCATCAAAGTATTTGCC GATGAGCATCTTTAAACTGG 100 52 45
rs525720 GTTCTTGACTGGAGCTTTG GCCAGTGCCCAGTTTTCTAT 103 45.6 33.3
rs670957 ATGCCAAGAGTAGAACTGCC TCTGACACCAGTCCCATTTC 97 45.5 50