Skip to main content

Table 1 Characteristics of PCR primers sequence, target fragment length and annealing temperature used for genotyping MTHFR polymorphisms

From: Association of methylenetetrahytrofolate reductase (MTHFR) C677T and A1298C polymorphisms with the susceptibility of childhood acute lymphoblastic leukaemia (ALL) in Chinese population

Polymorphisms sites   Primers sequence (5′ → 3′) Fragment length Annealing temperature
MTHFR C677T F AGTCCCTGTGGTCTCTTCATC 387 bp 56°C
R GGAGATCTGGGAAGAACTCAG
MTHFR A1298C F CTTTGGGGAGCTGAAGGACTACTAC 168 bp 55°C
R CACTTTGTGACCATTCCGGTTTG