Skip to main content

Table 1 Differential basilar membrane miRNA (microRNA) expression of mature to newborn rat

From: Profiles of the auditory epithelia related microRNA expression in neonatal and adult rats

miRNA ID Fold change(2-CT) Style Sequence
rno-miR-296-star 601.8687077 up AGGGCCCCCCCUCAAUCCUGU
rno-miR-183 311.2671462 up UAUGGCACUGGUAGAAUUCACU
rno-miR-130b 73.88701805 up CAGUGCAAUGAUGAAAGGGCAU
rno-miR-298 73.54126053 up GGCAGAGGAGGGCUGUUCUUCCC
rno-miR-199a-5p 39.0786033 up CCCAGUGUUCAGACUACCUGUUC
rno-miR-106b-star 38.46729557 up CCGCACUGUGGGUACUUGCUGC
rno-miR-323 37.0342188 up CACAUUACACGGUCGACCUCU
rno-miR-301b 36.10785966 up CAGUGCAAUGGUAUUGUCAAAGC
rno-miR-342-5p 19.28817847 up AGGGGUGCUAUCUGUGAUUGAG
rno-miR-19a 18.83546833 up UGUGCAAAUCUAUGCAAAACUGA
rno-miR-18a 18.76863728 up UAAGGUGCAUCUAGUGCAGAUAG
rno-miR-487b 18.75103727 up AAUCGUACAGGGUCAUCCACUU
rno-miR-20a 18.57354895 up UAAAGUGCUUAUAGUGCAGGUAG
rno-miR-344a-3p 18.35504823 up UGAUCUAGCCAAAGCCUGACCGU
rno-miR-431 17.97658408 up UGUCUUGCAGGCCGUCAUGCA
rno-miR-301a 17.94604464 up CAGUGCAAUAGUAUUGUCAAAGC
rno-miR-29c 0.071923249 down UAGCACCAUUUGAAAUCGGUUA
rno-miR-29a 0.035852454 down UAGCACCAUCUGAAAUCGGUUA