Skip to main content

Table 1 Primers used for quantitative RT-PCR

From: The effects of aqueous extract of Maca on energy metabolism and immunoregulation

Genes Forward (5′–3′) Reverse (5′–3′)
β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT
IL-2 TGAGCAGGATGGAGAATTACAGG GTCCAAGTTCATCTTCTAGGCAC
IFN-γ ATGAACGCTACACACTGCATC CCATCCTTTTGCCAGTTCCTC
TNF-β GTCTGTGTATCCGGGACTTCA TCTCCCTTACTGAGCAGGAAC
IL-4 CCCCAGCTAGTTGTCATCCTG CAAGTGATTTTTGTCGCATCCG