Skip to main content

Table 1 PCR primers (in the 5′ – 3′ direction)

From: Fracture fixation strategy and specific muscle tissue availability of neutrophilic granulocytes following mono- and polytrauma: intramedullary nailing vs. external fixation of femoral fractures

Primer Sequence 5′-3′
Sus scrofa domesticus  
β-Actin forward GGACTTCGAGCAGGAGATGG
β-Actin reverse GCACCGTGTTGGCGTAGAGG
RSP 18 forward GGGTGTAGGACGGAGATAT
RSP 18 reverse ATTACACGTTCCACCTCATC
HPRT forward GTCAAGCAGCATAATCCAAAG
HPRT reverse AAGGGCATAGCCTACCACAA
PPIA forward AGCACTGGGGAGAAAGGATT
PPIA reverse AAAACTGGGAACCGTTTG
Interleukin 6 forward GAATCCAGACAAAGCCACCA
Interleukin 6 reverse GTGCCCCAGCTACATTATCC
Interleukin 8 forward ACTGCTGTTGTTGTTGCTTC
Interleukin 8 reverse ATATCTGTACAACCTTCTGC
  1. The PCR was run with the specified primers on a StepOne Plus RT device