Skip to main content

Table 1 Primers used for qRT-PCR determinations

From: Effect of infusion irrigation with different irrigating solutions on transient receptor potential vanilloid 5 and intra-articular inflammation in a post-traumatic osteoarthritis rabbit model

Gene species GenBank ID Strand Sequence 5′–3′
IL-1β Rabbit NM_001082201.1 Forward GCC GAT GGT CCC AAT TAC AT
Reverse ACA AGA CCT GCC GGA AGC T
MMP-3 Rabbit NM_001082280.1 Forward GCC AAG AGA TGC TGT TGA TG
Reverse AGG TCT GTG AAG GCG TTG TA
GAPDH Rabbit NM_001082253.1 Forward GGAGGCAGGGATGATGTTCT
Reverse TGTTTGTGATGGGCGTGAA