Skip to main content

Identification of a novel de novo pathogenic variant in GFAP in an Iranian family with Alexander disease by whole-exome sequencing

Abstract

Background

Alexander disease (AxD) is a rare leukodystrophy with an autosomal dominant inheritance mode. Variants in GFAP lead to this disorder and it is classified into three distinguishable subgroups: infantile, juvenile, and adult-onset types.

Objective

The aim of this study is to report a novel variant causing AxD and collect all the associated variants with juvenile and adult-onset as well.

Methods

We report a 2-year-old female with infantile AxD. All relevant clinical and genetic data were evaluated. Search strategy for all AxD types was performed on PubMed. The extracted data include total recruited patients, number of patients carrying a GFAP variant, nucleotide and protein change, zygosity and all the clinical symptoms.

Results

A novel de novo variant c.217A > G: p. Met73Val was found in our case by whole-exome sequencing. In silico analysis categorized this variant as pathogenic. Totally 377 patients clinically diagnosed with juvenile or adult-onset forms were recruited in these articles, among them 212 patients were affected with juvenile or adult-onset form carrier of an alteration in GFAP. A total of 98 variants were collected. Among these variants c.262C > T 11/212 (5.18%), c.1246C > T 9/212 (4.24%), c.827G > T 8/212 (3.77%), c.232G > A 6/212 (2.83%) account for the majority of reported variants.

Conclusion

This study highlighted the role of genetic in AxD diagnosing. It also helps to provide more information in order to expand the genetic spectrum of Iranian patients with AxD. Our literature review is beneficial in defining a better genotype–phenotype correlation of AxD disorder.

Introduction

Alexander disease (AxD) (OMIM #203450) is a rare leukodystrophy first described in 1949 with usually infantile manifestation. The exact prevalence of AxD is not known, however a Japanese investigation estimated an incidence of 1 person in 2.7 million. This disorder belongs to a group of neurological diseases denoted as leukodystrophies affecting the central nervous system (CNS) white matter and characterized by myelin sheath defects or abnormal development of myelin sheath [1, 2]. According to age of onset, AxD is classified in to three subgroups naming infantile, juvenile and adult forms [3]. Patients affected with infantile AxD present various symptoms such as seizures, megalencephaly, developmental delay, progressive deterioration and increased neonatal patients severity within first two years after birth [4]. Juvenile form with the age of onset (2–14 years of age) is characterized by symptoms including ataxia, hyperreflexia, bulbar symptoms. Juvenile form has milder progression and preserved cognitive and motor function comparing to infantile form. Adult AxD patients have more similarities to the juvenile form and manifest mainly spastic paraparesis, palatal myoclonus, bulbar symptoms and ataxia [5]. AxD is usually diagnosed based on the results of CT and MRI characteristic appearances—reference. Frontal predominance involvement, hindbrain involvement, medulla oblongata and cervical spinal cord atrophy are indicators of younger patients and patients with later onset, respectively [6,7,8]. This autosomal dominant disorder is usually the consequence of defects in GFAP gene [9]. Sporadic cases should be mentioned briefly GFAP is located within chromosome 17q21 consists of nine exons spreading 9.8 kb length encoding a 432 amino acid protein. This protein belongs to intermediate filament proteins and has considerable and key roles in astrocytes morphology and motility regulation and astrocytes and oligodendrocytes interaction. The exact and precise mechanism through which GFAP function is not completely understood, however, it is believed that gain of function mutations in GFAP affects and disrupts intermediate filaments dimerization leading to abnormal aggregation of proteins and cytoskeleton collapse [3, 10, 11]. GFAP identification and sequencing have increased the level of diagnosis accuracy and statistical analysis have evaluated the relationships between onset age and the GFAP genotype and its clinical outcomes [12]. Nearly all of the GFAP disease-causing mutations are heterozygous single base-pair alterations located in the coding region especially in central rod domain conserved α-helices. The remaining mutations are near the N-terminus precoil domain and C-terminal tail domain [3, 13]. In this study, we report a GFAP novel variant in a 2-year-old female affected with infantile form and conduct a comprehensive review on all of the reported GFAP mutations in patients with adult and juvenile forms as well.

Methods

Case clinical features and demographic data

A 2-year-old female patient referred to Cardiogenetic Research Center, Rajaie Cardiovascular Medical and Research Center, Iran University of Medical Sciences, Tehran, Iran, suffering from developmental delay and vomiting during one year after her birth. She was born through cesarean delivery and she was the only child of one healthy non-consanguineous parents (Fig. 1A). Her birth weight and head circumference were 2350 g and 33.9 cm, respectively. At age 24 months, she manifested some further symptoms including seizure and motor and speech delays. She could not also sit independently. The patient presented spasticity and increased deep tendon reflexes (DTRs). Further neurological examination also revealed ataxia and she had also gait disturbance. The clinical surveys of other available members of the pedigree were normal. After conducting clinical evaluations and family history recording and genetic counselling, whole-exome sequencing [14] was conducted for precise diagnosis. Identified candidate variant was confirmed and segregated in family members using PCR and direct Sanger sequencing. The study was performed in accordance with the Helsinki Declaration and has been approved by the Rajaei Cardiovascular, Medical, and Research Center ethics committee (IR.RHC.REC.1400.077).

Fig. 1
figure 1

Genetic and protein changes of GFAP. A The pedigree of a family with Alexander disease. The black arrow indicates proband. Affected and unaffected individuals are represented by filled and clean symbols, respectively. B Sanger sequencing results show that a novel de novo variant in the GFAP was found in the proband (III-1) and normal sequence of her parents (II-4/II-5). C Conservation of p.Met73Val variant across various species has been shown. The variant site is highly conserved in various species. D, E Schematic view of GFAP and the position of mutation p.Met73Val

MRI

Her first brain magnetic resonance imaging (MRI) at the age of 24 months indicated diffuse hyperintensity in periventricular and subcortical white matter of frontal and parietal lobes. Furthermore, basal ganglia indicated hyperintensity on apparent diffusion coefficient (ADC) maps. The brainstem and cerebellum had no abnormalities. Her MRI suggested leukodystrophy or hypoxic–ischemic encephalopathy. Her MRI reveals white matter involvement.

Whole-exome sequencing

Informed consent was obtained from the proband’s parents. DNA extraction was conducted according to salting out method. The quality and quantity of extracted DNA was checked by agarose gel electrophoresis and NanoDrop (Thermo Fisher Scientific, USA). DNA sample of the proband (III-1) (Fig. 1A) was subjected to WES and was conducted using at Macrogen (Seoul, South Korea) and raw data (fastq) was analyzed by Cardiogenetic Research Center, Rajaie Cardiovascular, Medical, and Research Center, Tehran, Iran.

The short reads alignment with human reference genome (UCSC build37/hg19) was performed by BWA (http://bio-bwa.sourceforge.net/) [15]. Any alterations including insertions/deletions (indels), single-nucleotide polymorphisms (SNPs) and polymerase chain reaction (PCR) duplicates removal were detected using Picard (http://picard.sourceforge.net/), SAMtools (http://www.htslib.org/) [16], and GATK (https://www.broadinstitute.org/gatk/) [17]. After annotation by annovar (http://annovar.openbioinformatics.org) [18], variants with minor allele frequency (MAF) < 0.05 were selected and filtered. In order to assess deleterious effects of variants, bioinformatics tools were applied including combined annotation dependent depletion (CADD; https://cadd.gs.washington.edu/home) [19], sorting intolerant from tolerant (SIFT; https://sift.bii.a-star.edu.sg/) [20], MutationTaster (http://www.mutationtaster.org/) [21], protein variation effect analyzer (PROVEAN; http://provean.jcvi.org/index.php) [22], polymorphism phenotyping v2 (PolyPhen-2; http://genetics.bwh.harvard.edu/pph2/) [23], genomic evolutionary rate profiling (GERP; http://mendel.stanford.edu/SidowLab/downloads/gerp/), and CLUSTALW (https://www.genome.jp/tools-bin/clustalw).

Validation, and bioinformatics analysis

The validation of identified variant was confirmed in the proband and segregated in other family members by PCR and direct Sanger-sequencing. PCR was performed using specific primers (forward primer: TTCATAAAGCCCTCGCATC, reverse primer: CGCTTCCAACTCCTCCTTTA) on a SimpliAmp Thermal Cycler (Thermo Fisher Scientific) and products were sequenced on an ABI Sequencer 3500XL PE (Applied Biosystems). The sequences were analyzed by CodonCode Aligner 7.1.2 (https://www.codoncode.com/aligner/).

Search strategy and data extraction

The combination of following keywords GFAP and Alexander disease, “GFAP mutations” and GFAP” [title/abstract] were used searching PubMed. Totally 954 articles were collected and after duplicate removal, 868 articles remained. The inclusion criteria include patients affected with juvenile and adult-onset form of AxD who carried an alteration in GFAP.

According to our defined inclusion criteria, nucleotide and protein change, zygosity, number of total recruited patients and GFAP carriers, main clinical symptoms were extracted from the selected articles (Table 1). All the collected variants were analyzed by different in silico tools such as Clinvar, SIFT, Mutation Taster, PROVEAN, GERP, ACMG, CADD and Polyphen-2 (Table 2).

Table 1 Data extraction
Table 2 Bioinformatics analysis of GFAP collected variants related to Alexander disease

Results

Our genetic investigation revealed a novel de novo pathogenic variant, c.217A > G (p. Met73Val) in the recruited patient. Segregation analysis in the proband’s parents confirmed the identified variant of WES (Fig. 1B). The sequence alignments of proteins displayed the variant occurred within a highly conserved amino acid across various species, which provides its essential performance (Fig. 1C). Using schematic view of GFAP, the location of p.Met73Val was visualized. The identified variant is located on coil 1A of rod domain (Fig. 1D, E). Bioinformatic analysis by different tools such as Mutation Taster, PROVEAN, PolyPhen-2, CADD, SIFT, and GERP categorized this variant as disease causing, neutral (Score: -1.540), possibly damaging (Score: 0.526), PHRED: 21.8, damaging (Score: 0.005), and Score: 3.73, respectively.

Our search strategy and data extraction led to collection of 86 articles that met our defined inclusion criteria. Totally 377 patients were recruited in these articles, among them 212 patients were affected with juvenile or adult-onset form carrier of an alteration in GFAP. 202 mutations were reported and among them 98 were unique (without duplication). c.262C > T 11/212 (5.18%), c.1246C > T 9/212 (4.24%), c.827G > T 8/212 (3.77%), c.232G > A 6/212 (2.83%) were more frequent comparing to other fulfilled mutations. Our search analysis revealed that bulbar signs 115/212 (54.24%), ataxia 74/212 (34.9%) and spasticity 59/212 (27.83%) were the dominant clinical symptoms among carrier of GFAP variants (Fig. 2).

Fig. 2
figure 2

The clinical symptoms frequency among affected patients

According to our analysis, mutations located on coil2B (24.74%) and coil1A (23.71%) constituted the majority of reported mutations in juvenile and adult-onset forms (Table 2). Among these 98 unique fulfilled variants 54 and 35 variants were categorized as likely pathogenic and pathogenic, respectively (Table 2).

Discussion

Gain of function variants in GFAP are associated with different forms of AxD as a neurodegenerative disorder with autosomal dominant inheritance mode [3, 24]. GFAP is an important conserved intermediate filament protein with high expression level in astrocytes playing a significant role in central nervous system (CNS). Altered GFAP loses ability of extracellular K+ clearing and gliotic tissue hyperexcitability as the consequence [25]. This leads to astrocyte function impairment, demyelination changes and aggregation of Rosenthal fiber [26]. A comprehensive search on variants causing juvenile and adult was conducted and all the collected variants were analyzed by different in silico tools. Besides, our genetic analysis revealed a novel de novo variant in GFAP naming c.217A > G results in a methionine substitution to valine at codon 73 located in Coil 1A. GFAP-α (alpha) is the most abundant form of GFAP consists of head coil domain followed by the rod (filament) domain. Rod domain is also composed of four coils (1A, 1B, 2A, 2B). Reported variants near or within coil1A are Met73Lys, Met73Thr, and Met73Arg [13, 27,28,29]. Previous studies indicated that variants located within 1A, 1B and 2B domains may strongly cause severe form of AxD [13]. Met73Lys was first reported in a 7-month-old girl manifesting seizures and spasticity, but she did not indicate any bulbar signs or ataxia [27] and Met73Thr was reported in a 3-month-old girl. Her main clinical symptoms were macrocephaly, seizures, spasticity, bulbar signs, and ataxia [13]. Met73Arg is the third variant within this region and was reported in a patient with juvenile form. Her initial symptom was strabismus. In addition to the above-mentioned variants, Met73Ile and Met73Arg located in coil1A are also reported for patients affected with adult-onset form [30, 31]. Most of the reported mutations in GFAP gene are de novo and with 100% penetrance [3, 32]. A study conducted by Xiaoxuan Song et al. in 2021, two de novo mutations naming c.214G > A and c.1235C > T were reported in two unrelated individuals [33]. Both patients indicate regional neural activity increase. In this study, patient who was carrier of c.1235C > T manifests atrophy of grey matter mainly involving thalamus and bilateral putamen. Grey matter volume loss may be associated with disability in the long run [34]. AxD is inherited in autosomal dominant mode, however, in an investigation by Mu-Hui Fu et al.in 2020, a homozygous substitution naming c.197G > A (p.Arg66Gln) in a man with the onset age 16 was reported. This was the first report of a GFAP homozygous mutation [35].

Previous studies showed that c.715C > T (Arg239Cys) is the most common variant identified in Infantile AxD patients, however, c.262C > T (Arg88Cys) and c.1246C > T (Arg416Trp) are the two common variants of other two types. These variants are mainly located in Coil2B domain and Coil1A and therefore they are hotspot regions of GFAP. Our literature review indicated that bulbar signs, ataxia and spasticity constitutes the majority of clinical symptoms of GFAP carriers with juvenile and adult-onset AxD. A review conducted by Heshmatzad et al. in 2021 revealed that 59.70% of infantile AxD patients carrying a GFAP alteration, manifest seizure, spasticity, macrocephaly, and developmental as the dominant clinical symptoms [36]. These results indicated that spasticity is one of the most important signs among all AxD groups. Despite all the promising results of DNA analysis, next-generation sequencing [37] implementation, further studies are needed to categorize GFAP gene variants as a reliable genetic marker for AxD patients. There are only a few published articles investigating the genetics of Iranian patients affected with AxD [36, 38]. This fact highlights the important role of genetic in AxD diagnosis. More large-scale studies with the help of genetic analysis should be conducted in order to expand our knowledge of AxD.

Accession Number

The accession number of the variant in ClinVar is as follows:

NM_002055.5 (GFAP): c.217A > G (p.Met73Val): VCV001173085.1.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

References

  1. Barkovich AJ, Messing A. Alexander disease: not just a leukodystrophy anymore. In: AAN Enterprises; 2006.

  2. Yoshida T, Sasaki M, Yoshida M, Namekawa M, Okamoto Y, Tsujino S, et al. Nationwide survey of Alexander disease in Japan and proposed new guidelines for diagnosis. J Neurol. 2011;258(11):1998–2008.

    Article  Google Scholar 

  3. Brenner M, Johnson AB, Boespflug-Tanguy O, Rodriguez D, Goldman JE, Messing A. Mutations in GFAP, encoding glial fibrillary acidic protein, are associated with Alexander disease. Nat Genet. 2001;27(1):117–20.

    Article  CAS  Google Scholar 

  4. Springer S, Erlewein R, Naegele T, Becker I, Auer D, Grodd W, et al. Alexander disease-classification revisited and isolation of a neonatal form. Neuropediatrics. 2000;31(02):86–92.

    Article  CAS  Google Scholar 

  5. Johnson AB. Alexander disease: a review and the gene. Int J Dev Neurosci. 2002;20(3–5):391–4.

    Article  CAS  Google Scholar 

  6. Namekawa M, Takiyama Y, Aoki Y, Takayashiki N, Sakoe K, Shimazaki H, et al. Identification of GFAP gene mutation in hereditary adult-onset Alexander’s disease. Ann Neurol. 2002;52(6):779–85. https://doi.org/10.1002/ana.10375.

    Article  CAS  PubMed  Google Scholar 

  7. van der Knaap MS, Ramesh V, Schiffmann R, Blaser S, Kyllerman M, Gholkar A, et al. Alexander disease: ventricular garlands and abnormalities of the medulla and spinal cord. Neurology. 2006;66(4):494–8. https://doi.org/10.1212/01.wnl.0000198770.80743.37.

    Article  PubMed  Google Scholar 

  8. van der Knaap MS, Salomons GS, Li R, Franzoni E, Gutiérrez-Solana LG, Smit LM, et al. Unusual variants of Alexander’s disease. Ann Neurol. 2005;57(3):327–38. https://doi.org/10.1002/ana.20381.

    Article  PubMed  Google Scholar 

  9. Paprocka J, Rzepka-Migut B, Rzepka N, Jezela-Stanek A, Morava E. Infantile Alexander disease with late onset infantile spasms and hypsarrhythmia. Balkan J Med Genet. 2019;22(2):77.

    Article  CAS  Google Scholar 

  10. Eng LF, Ghirnikar RS, Lee YL. Glial fibrillary acidic protein: GFAP-thirty-one years (1969–2000). Neurochem Res. 2000;25(9):1439–51.

    Article  CAS  Google Scholar 

  11. Nielsen AL, Jørgensen P, Jørgensen AL. Mutations associated with a childhood leukodystrophy, Alexander disease, cause deficiency in dimerization of the cytoskeletal protein GFAP. J Neurogenet. 2002;16(3):175–9. https://doi.org/10.1080/01677060215305.

    Article  CAS  PubMed  Google Scholar 

  12. Prust M, Wang J, Morizono H, Messing A, Brenner M, Gordon E, et al. GFAP mutations, age at onset, and clinical subtypes in Alexander disease. Neurology. 2011;77(13):1287–94.

    Article  CAS  Google Scholar 

  13. Li R, Johnson AB, Salomons G, Goldman JE, Naidu S, Quinlan R, et al. Glial fibrillary acidic protein mutations in infantile, juvenile, and adult forms of Alexander disease. Ann Neurol. 2005;57(3):310–26. https://doi.org/10.1002/ana.20406.

    Article  CAS  PubMed  Google Scholar 

  14. Rowczenio DM, Noor I, Gillmore JD, Lachmann HJ, Whelan C, Hawkins PN, et al. Online registry for mutations in hereditary amyloidosis including nomenclature recommendations. Hum Mutat. 2014;35(9):E2403–12.

    Article  CAS  Google Scholar 

  15. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25(14):1754–60.

    Article  CAS  Google Scholar 

  16. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The sequence alignment/map format and SAMtools. Bioinformatics. 2009;25(16):2078–9.

    Article  Google Scholar 

  17. McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, et al. The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res. 2010;20(9):1297–303.

    Article  CAS  Google Scholar 

  18. Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucl Acids Res. 2010;38(16):e164-e.

    Article  Google Scholar 

  19. Kircher M, Witten DM, Jain P, O’roak BJ, Cooper GM, Shendure J. A general framework for estimating the relative pathogenicity of human genetic variants. Nat Genet. 2014;46(3):310–5.

    Article  CAS  Google Scholar 

  20. Kumar P, Henikoff S, Ng PC. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc. 2009;4(7):1073–81.

    Article  CAS  Google Scholar 

  21. Schwarz JM, Cooper DN, Schuelke M, Seelow D. MutationTaster2: mutation prediction for the deep-sequencing age. Nat Methods. 2014;11(4):361–2.

    Article  CAS  Google Scholar 

  22. Choi Y, Chan AP. PROVEAN web server: a tool to predict the functional effect of amino acid substitutions and indels. Bioinformatics. 2015;31(16):2745–7.

    Article  CAS  Google Scholar 

  23. Adzhubei I, Jordan DM, Sunyaev SR. Predicting functional effect of human missense mutations using PolyPhen‐2. Curr Protoc Hum Genet. 2013;76 1:7.20. 1–7. 41.

  24. van der Knaap MS, Naidu S, Breiter SN, Blaser S, Stroink H, Springer S, et al. Alexander disease: diagnosis with MR imaging. AJNR Am J Neuroradiol. 2001;22(3):541–52.

    PubMed  PubMed Central  Google Scholar 

  25. Walz W, Wuttke WA. Independent mechanisms of potassium clearance by astrocytes in gliotic tissue. J Neurosci Res. 1999;56(6):595–603.

    Article  CAS  Google Scholar 

  26. Messing A, Goldman JE, Johnson AB, Brenner M. Alexander disease: new insights from genetics. J Neuropathol Exp Neurol. 2001;60(6):563–73.

    Article  CAS  Google Scholar 

  27. Caroli F, Biancheri R, Seri M, Rossi A, Pessagno A, Bugiani M, et al. GFAP mutations and polymorphisms in 13 unrelated Italian patients affected by Alexander disease. Clin Genet. 2007;72(5):427–33. https://doi.org/10.1111/j.1399-0004.2007.00869.x.

    Article  CAS  PubMed  Google Scholar 

  28. Gorospe J, Naidu S, Johnson A, Puri V, Raymond G, Jenkins S, et al. Molecular findings in symptomatic and pre-symptomatic Alexander disease patients. Neurology. 2002;58(10):1494–500.

    Article  CAS  Google Scholar 

  29. Posey JE, Harel T, Liu P, Rosenfeld JA, James RA, Coban Akdemir ZH, et al. Resolution of disease phenotypes resulting from multilocus genomic variation. N Engl J Med. 2017;376(1):21–31.

    Article  CAS  Google Scholar 

  30. Ciammola A, Sangalli D, Sassone J, Poletti B, Carelli L, Banfi P, et al. A novel mutation of GFAP causing adult-onset Alexander disease. Front Neurol. 2019;10:1124.

    Article  Google Scholar 

  31. Hayano E, Shimizu M, Baba K, Shimamura M, Yoshida T, Mochizuki H. A case of Alexander disease presented with dystonia of lower limb and decreased dopaminergic uptake in dopamine transporter scintigraphy. Rinsho shinkeigaku Clin Neurol. 2020;60(10):712–5. https://doi.org/10.5692/clinicalneurol.cn-001445.

    Article  Google Scholar 

  32. Rodriguez D, Gauthier F, Bertini E, Bugiani M, Brenner M, N’Guyen S, et al. Infantile Alexander disease: spectrum of GFAP mutations and genotype-phenotype correlation. Am J Hum Genet. 2001;69(5):1134–40. https://doi.org/10.1086/323799.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Song X, Jiang J, Tian W, Zhan F, Zhu Z, Li B, et al. A report of two cases of bulbospinal form Alexander disease and preliminary exploration of the disease. Mol Med Rep. 2021;24(2):1–12.

    Google Scholar 

  34. Eshaghi A, Prados F, Brownlee WJ, Altmann DR, Tur C, Cardoso MJ, et al. Deep gray matter volume loss drives disability worsening in multiple sclerosis. Ann Neurol. 2018;83(2):210–22.

    Article  CAS  Google Scholar 

  35. Fu MH, Chang YY, Lin NH, Yang AW, Chang CC, Liu JS, et al. Recessively-inherited adult-onset Alexander disease caused by a homozygous mutation in the GFAP gene. Mov Disord. 2020;35(9):1662–7.

    Article  CAS  Google Scholar 

  36. Heshmatzad K, Haghi Panah M, Tavasoli AR, Ashrafi MR, Mahdieh N, Rabbani B. GFAP variants leading to infantile Alexander disease: Phenotype and genotype analysis of 135 cases and report of a de novo variant. Clin Neurol Neurosurg. 2021;207: 106754. https://doi.org/10.1016/j.clineuro.2021.106754.

    Article  PubMed  Google Scholar 

  37. Jefferson RJ, Absoud M, Jain R, Livingston JH, van der Knaap MS, Jayawant S. Alexander disease with periventricular calcification: a novel mutation of the GFAP gene. Dev Med Child Neurol. 2010;52(12):1160–3. https://doi.org/10.1111/j.1469-8749.2010.03784.x.

    Article  PubMed  Google Scholar 

  38. Ashrafi MR, Tavasoli A, Aryani O, Alizadeh H, Houshmand M. Alexander disease: report of two unrelated infantile form cases, identified by GFAP mutation analysis and review of literature; the first report from Iran. Iran J Pediatr. 2013;23(4):481–4.

    PubMed  PubMed Central  Google Scholar 

  39. Aoki Y, Haginoya K, Munakata M, Yokoyama H, Nishio T, Togashi N, et al. A novel mutation in glial fibrillary acidic protein gene in a patient with Alexander disease. Neurosci Lett. 2001;312(2):71–4. https://doi.org/10.1016/s0304-3940(01)02139-5.

    Article  CAS  PubMed  Google Scholar 

  40. Asahina N, Okamoto T, Sudo A, Kanazawa N, Tsujino S, Saitoh S. An infantile-juvenile form of Alexander disease caused by a R79H mutation in GFAP. Brain Dev. 2006;28(2):131–3. https://doi.org/10.1016/j.braindev.2005.05.004.

    Article  PubMed  Google Scholar 

  41. Balbi P, Seri M, Ceccherini I, Uggetti C, Casale R, Fundarò C, et al. Adult-onset Alexander disease: report on a family. J Neurol. 2008; 255(1):24–30. https://doi.org/10.1007/s00415-007-0654-0.

  42. Barreau P, Prust MJ, Crane J, Loewenstein J, Kadom N, Vanderver A. Focal central white matter lesions in Alexander disease. J Child Neurol. 2011;26(11):1422–4. https://doi.org/10.1177/0883073811405381.

    Article  PubMed  PubMed Central  Google Scholar 

  43. Benzoni C, Aquino D, Di Bella D, Sarto E, Moscatelli M, Pareyson D, et al. Severe worsening of adult-onset Alexander disease after minor head trauma: report of two patients and review of the literature. J Clin Neurosci. 2020;75:221–3. https://doi.org/10.1016/j.jocn.2020.03.033.

    Article  PubMed  Google Scholar 

  44. Biancheri R, Rossi A, Ceccherini I, Pezzella M, Prato G, Striano P, et al. Magnetic resonance imaging “tigroid pattern” in Alexander disease. Neuropediatrics. 2013;44(3):174–6. https://doi.org/10.1055/s-0032-1329910.

    Article  PubMed  Google Scholar 

  45. Bonthius DJ, Karacay B. Alexander disease: a novel mutation in GFAP leading to Epilepsia Partialis Continua. J Child Neurol. 2016;31(7):869–72. https://doi.org/10.1177/0883073815624762.

    Article  PubMed  Google Scholar 

  46. Brenner M, Messing A. A new mutation in GFAP widens the spectrum of Alexander disease. Eur J Hum Genet. 2015;23(1):1–2. https://doi.org/10.1038/ejhg.2014.99.

    Article  CAS  PubMed  Google Scholar 

  47. Brockmann K, Meins M, Taubert A, Trappe R, Grond M, Hanefeld F. A novel GFAP mutation and disseminated white matter lesions: adult Alexander disease? Eur Neurol. 2003;50(2):100–5. https://doi.org/10.1159/000072507.

    Article  PubMed  Google Scholar 

  48. Cabrera-Galván JJ, Martínez-Martin MS, Déniz-García D, Araujo-Ruano E, Travieso-Aja MDM. Adult-onset Alexander disease with a heterozygous D128N GFAP mutation: a pathological study. Histol Histopathol. 2019;34(9):1073–188. https://doi.org/10.14670/hh-18-110.

    Article  CAS  PubMed  Google Scholar 

  49. Casasnovas C, Verdura E, Vélez V, Schlüter A, Pons-Escoda A, Homedes C, et al. A novel mutation in the GFAP gene expands the phenotype of Alexander disease. J Med Genet. 2019;56(12):846–9. https://doi.org/10.1136/jmedgenet-2018-105959.

    Article  CAS  PubMed  Google Scholar 

  50. Chang KE, Pratt D, Mishra BB, Edwards N, Hallett M, Ray-Chaudhury A. Type II (adult onset) Alexander disease in a paraplegic male with a rare D128N mutation in the GFAP gene. Clin Neuropathol. 2015;34(5):298–302. https://doi.org/10.5414/np300863.

    Article  PubMed  PubMed Central  Google Scholar 

  51. de Paiva AR, Freua F, Lucato LT, Parmera J, Dória D, Nóbrega PR, et al. A novel GFAP mutation in a type II (late-onset) Alexander disease patient. J Neurol. 2016;263(4):821–2. https://doi.org/10.1007/s00415-016-8065-8.

    Article  PubMed  Google Scholar 

  52. Elmali AD, Çetinçelik Ü, Işlak C, Uzun Adatepe N, Karaali Savrun F, Yalçinkaya C. Familial adult-onset alexander disease: clinical and neuroradiological findings of three cases. Noro Psikiyatr Ars. 2016;53(2):169–72. https://doi.org/10.5152/npa.2015.10193.

    Article  PubMed  PubMed Central  Google Scholar 

  53. Farina L, Pareyson D, Minati L, Ceccherini I, Chiapparini L, Romano S, et al. Can MR imaging diagnose adult-onset Alexander disease? AJNR Am J Neuroradiol. 2008;29(6):1190–6. https://doi.org/10.3174/ajnr.A1060.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  54. Flint D, Li R, Webster LS, Naidu S, Kolodny E, Percy A, et al. Splice site, frameshift, and chimeric GFAP mutations in Alexander disease. Hum Mutat. 2012;33(7):1141–8. https://doi.org/10.1002/humu.22094.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  55. Gass JM, Cheema A, Jackson J, Blackburn PR, Van Gerpen J, Atwal PS. Novel GFAP variant in adult-onset Alexander disease with progressive ataxia and palatal tremor. Neurologist. 2017;22(6):247–8. https://doi.org/10.1097/nrl.0000000000000153.

    Article  PubMed  Google Scholar 

  56. Helman G, Takanohashi A, Hagemann TL, Perng MD, Walkiewicz M, Woidill S, et al. Type II Alexander disease caused by splicing errors and aberrant overexpression of an uncharacterized GFAP isoform. Hum Mutat. 2020;41(6):1131–7. https://doi.org/10.1002/humu.24008.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  57. Hida A, Ishiura H, Arai N, Fukuoka H, Hasuo K, Goto J, et al. Adult-onset Alexander disease with an R66Q mutation in GFAP presented with severe vocal cord paralysis during sleep. J Neurol. 2012;259(10):2234–6. https://doi.org/10.1007/s00415-012-6540-4.

    Article  PubMed  Google Scholar 

  58. Hinttala R, Karttunen V, Karttunen A, Herva R, Uusimaa J, Remes AM. Alexander disease with occipital predominance and a novel c.799G>C mutation in the GFAP gene. Acta Neuropathol. 2007;114(5):543–5. https://doi.org/10.1007/s00401-007-0292-8.

    Article  PubMed  Google Scholar 

  59. Howard KL, Hall DA, Moon M, Agarwal P, Newman E, Brenner M. Adult-onset Alexander disease with progressive ataxia and palatal tremor. Mov Disord. 2008;23(1):118–22. https://doi.org/10.1002/mds.21774.

    Article  PubMed  Google Scholar 

  60. Ishigaki K, Ito Y, Sawaishi Y, Kodaira K, Funatsuka M, Hattori N, et al. TRH therapy in a patient with juvenile Alexander disease. Brain Dev. 2006;28(10):663–7. https://doi.org/10.1016/j.braindev.2006.05.001.

    Article  PubMed  Google Scholar 

  61. Iwasaki Y, Saito Y, Mori K, Ito M, Mimuro M, Aiba I, et al. An autopsied case of adult-onset bulbospinal form Alexander disease with a novel S393R mutation in the GFAP gene. Clin Neuropathol. 2015;34(4):207–14. https://doi.org/10.5414/np300806.

    Article  PubMed  Google Scholar 

  62. Kaneko H, Hirose M, Katada S, Takahashi T, Naruse S, Tsuchiya M, et al. Novel GFAP mutation in patient with adult-onset Alexander disease presenting with spastic ataxia. Mov Disord. 2009;24(9):1393–5. https://doi.org/10.1002/mds.22556.

    Article  PubMed  Google Scholar 

  63. Karp N, Lee D, Shickh S, Jenkins ME. c.1289G>A (p.Arg430His) variant in the epsilon isoform of the GFAP gene in a patient with adult onset Alexander disease. Eur J Med Genet. 2019;62(4):235–8. https://doi.org/10.1016/j.ejmg.2018.07.020.

    Article  PubMed  Google Scholar 

  64. Kinoshita T, Imaizumi T, Miura Y, Fujimoto H, Ayabe M, Shoji H, et al. A case of adult-onset Alexander disease with Arg416Trp human glial fibrillary acidic protein gene mutation. Neurosci Lett. 2003;350(3):169–72. https://doi.org/10.1016/s0304-3940(03)00900-5.

    Article  CAS  PubMed  Google Scholar 

  65. Kyllerman M, Rosengren L, Wiklund LM, Holmberg E. Increased levels of GFAP in the cerebrospinal fluid in three subtypes of genetically confirmed Alexander disease. Neuropediatrics. 2005;36(5):319–23. https://doi.org/10.1055/s-2005-872876.

    Article  CAS  PubMed  Google Scholar 

  66. Lee SH, Nam TS, Kim KH, Kim JH, Yoon W, Heo SH, et al. Aggregation-prone GFAP mutation in Alexander disease validated using a zebrafish model. BMC Neurol. 2017;17(1):175. https://doi.org/10.1186/s12883-017-0938-7.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  67. Liu Y, Zhou H, Wang H, Gong X, Zhou A, Zhao L, et al. Atypical MRI features in familial adult onset Alexander disease: case report. BMC Neurol. 2016;16(1):211. https://doi.org/10.1186/s12883-016-0734-9.

    Article  PubMed  PubMed Central  Google Scholar 

  68. Maeda K, Iwai K, Kobayashi Y, Tsuji H, Yoshida T, Kobayashi Y. A case of Alexander disease with dropped head syndrome. Rinsho shinkeigaku Clin Neurol. 2018;58(3):198–201. https://doi.org/10.5692/clinicalneurol.cn-001116.

    Article  Google Scholar 

  69. Matsuyama Y, Satake M, Kamei R, Yoshida T. A case of Alexander disease with repeated loss of consciousness and with rapid aggravation of dysbasia by falling. Rinsho shinkeigaku Clin Neurol. 2020;60(2):137–41. https://doi.org/10.5692/clinicalneurol.cn-001341.

    Article  Google Scholar 

  70. Messing A, Li R, Naidu S, Taylor JP, Silverman L, Flint D, et al. Archetypal and new families with Alexander disease and novel mutations in GFAP. Arch Neurol. 2012;69(2):208–14. https://doi.org/10.1001/archneurol.2011.1181.

    Article  PubMed  Google Scholar 

  71. Mierzewska H, Mierzewska-Schmidt M, Salomons GS, Dudzińska M, Szczepanik E. Alexander disease—astrogliopathy considered as leukodystrophy—experience of an institution. Dev Period Med. 2016;20(2):110–7.

    PubMed  Google Scholar 

  72. Nam TS, Kim JH, Chang CH, Yoon W, Jung YS, Kang SY, et al. Identification of a novel nonsense mutation in the rod domain of GFAP that is associated with Alexander disease. Eur J Hum Genet. 2015;23(1):72–8. https://doi.org/10.1038/ejhg.2014.68.

    Article  CAS  PubMed  Google Scholar 

  73. Nam TS, Oh J, Levy M, Kang KW, Choi SY, Kim MK. A Novel GFAP mutation in late-onset Alexander disease showing diffusion restriction. J Clin Neurol. 2017;13(4):426–8. https://doi.org/10.3988/jcn.2017.13.4.426.

    Article  PubMed  PubMed Central  Google Scholar 

  74. Namekawa M, Takiyama Y, Honda J, Sakoe K, Naoi T, Shimazaki H, et al. A novel adult case of juvenile-onset Alexander disease: complete remission of neurological symptoms for over 12 years, despite insidiously progressive cervicomedullary atrophy. Neurolo Sci. 2012;33(6):1389–92. https://doi.org/10.1007/s10072-011-0902-z.

    Article  Google Scholar 

  75. Namekawa M, Takiyama Y, Honda J, Shimazaki H, Sakoe K, Nakano I. Adult-onset Alexander disease with typical “tadpole” brainstem atrophy and unusual bilateral basal ganglia involvement: a case report and review of the literature. BMC Neurol. 2010;10:21. https://doi.org/10.1186/1471-2377-10-21.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  76. Niinikoski H, Haataja L, Brander A, Valanne L, Blaser S. Alexander disease as a cause of nocturnal vomiting in a 7-year-old girl. Pediatr Radiol. 2009;39(8):872–5. https://doi.org/10.1007/s00247-009-1289-3.

    Article  PubMed  Google Scholar 

  77. Nobuhara Y, Nakahara K, Higuchi I, Yoshida T, Fushiki S, Osame M, et al. Juvenile form of Alexander disease with GFAP mutation and mitochondrial abnormality. Neurology. 2004;63(7):1302–4. https://doi.org/10.1212/01.wnl.0000140695.90497.e2.

    Article  CAS  PubMed  Google Scholar 

  78. Ogawa T, Ogaki K, Ishiguro M, Ando M, Yoshida T, Noda K, et al. Novel GFAP p. Glu206Ala mutation in Alexander disease with decreased dopamine transporter uptake. Mov Disord Clin Pract. 2020;7(6):720–2. https://doi.org/10.1002/mdc3.12998.

    Article  PubMed  PubMed Central  Google Scholar 

  79. Ogura H, Maki F, Sasaki N, Yoshida T, Hasegawa Y. Familial adult-onset Alexander disease with a Novel GFAP mutation. Mov Disord Clin Pract. 2016;3(3):300–2. https://doi.org/10.1002/mdc3.12296.

    Article  PubMed  PubMed Central  Google Scholar 

  80. Ohnari K, Yamano M, Uozumi T, Hashimoto T, Tsuji S, Nakagawa M. An adult form of Alexander disease: a novel mutation in glial fibrillary acidic protein. J Neurol. 2007;254(10):1390–4. https://doi.org/10.1007/s00415-007-0557-0.

    Article  CAS  PubMed  Google Scholar 

  81. Pareyson D, Fancellu R, Mariotti C, Romano S, Salmaggi A, Carella F, et al. Adult-onset Alexander disease: a series of eleven unrelated cases with review of the literature. Brain. 2008;131(Pt 9):2321–31. https://doi.org/10.1093/brain/awn178.

    Article  PubMed  Google Scholar 

  82. Salmaggi A, Botturi A, Lamperti E, Grisoli M, Fischetto R, Ceccherini I, et al. A novel mutation in the GFAP gene in a familial adult onset Alexander disease. J Neurol. 2007;254(9):1278–80. https://doi.org/10.1007/s00415-006-0361-2.

    Article  PubMed  Google Scholar 

  83. Sawaishi Y, Yano T, Takaku I, Takada G. Juvenile Alexander disease with a novel mutation in glial fibrillary acidic protein gene. Neurology. 2002;58(10):1541–3. https://doi.org/10.1212/wnl.58.10.1541.

    Article  CAS  PubMed  Google Scholar 

  84. Schmidt H, Kretzschmar B, Lingor P, Pauli S, Schramm P, Otto M, et al. Acute onset of adult Alexander disease. J Neurol Sci. 2013;331(1–2):152–4. https://doi.org/10.1016/j.jns.2013.05.006.

    Article  CAS  PubMed  Google Scholar 

  85. Schmidt S, Wattjes MP, Gerding WM, van der Knaap M. Late onset Alexander’s disease presenting as cerebellar ataxia associated with a novel mutation in the GFAP gene. J Neurol. 2011;258(5):938–40. https://doi.org/10.1007/s00415-010-5849-0.

    Article  PubMed  Google Scholar 

  86. Shiihara T, Sawaishi Y, Adachi M, Kato M, Hayasaka K. Asymptomatic hereditary Alexander’s disease caused by a novel mutation in GFAP. J Neurol Sci. 2004;225(1–2):125–7. https://doi.org/10.1016/j.jns.2004.07.008.

    Article  CAS  PubMed  Google Scholar 

  87. Zaver DB, Douthit NT. A novel mutation in the adult-onset Alexander’s disease GFAP gene. Case Rep Med. 2019;2019:2986538. https://doi.org/10.1155/2019/2986538.

    Article  PubMed  PubMed Central  Google Scholar 

  88. Zang L, Wang J, Jiang Y, Gu Q, Gao Z, Yang Y, et al. Follow-up study of 22 Chinese children with Alexander disease and analysis of parental origin of de novo GFAP mutations. J Hum Genet. 2013;58(4):183–8. https://doi.org/10.1038/jhg.2012.152.

    Article  CAS  PubMed  Google Scholar 

  89. Sugiyama A, Sawai S, Ito S, Mukai H, Beppu M, Yoshida T, et al. Incidental diagnosis of an asymptomatic adult-onset Alexander disease by brain magnetic resonance imaging for preoperative evaluation. J Neurol Sci. 2015;1(354):131–2.

    Article  Google Scholar 

  90. Yoshida T, Yasuda R, Mizuta I, Nakagawa M, Mizuno T. Quantitative evaluation of brain stem atrophy using magnetic resonance imaging in adult patients with Alexander disease. Eur Neurol. 2017;77(5–6):296–302. https://doi.org/10.1159/000475661.

    Article  PubMed  Google Scholar 

  91. Ye W, Qiang G, Jingmin W, Yanling Y, Xiru W, Yuwu J. Clinical and genetic study in Chinese patients with Alexander disease. J Child Neurol. 2008;23(2):173–7. https://doi.org/10.1177/0883073807308691.

    Article  Google Scholar 

  92. Yasuda R, Yoshida T, Mizuta I, Nakagawa M, Mizuno T. A novel three-base duplication, E243dup, of GFAP identified in a patient with Alexander disease. Hum Genome Var. 2017;4:17028. https://doi.org/10.1038/hgv.2017.28.

    Article  PubMed  PubMed Central  Google Scholar 

  93. Wada Y, Yanagihara C, Nishimura Y, Namekawa M. Familial adult-onset Alexander disease with a novel mutation (D78N) in the glial fibrillary acidic protein gene with unusual bilateral basal ganglia involvement. J Neurol Sci. 2013;331(1–2):161–4. https://doi.org/10.1016/j.jns.2013.05.019.

    Article  CAS  PubMed  Google Scholar 

  94. Vázquez-Justes D, Peñalva-García J, López R, Mitjana R, Begue R, González-Mingot C. Parkinsonism phenotype in a family with adult onset Alexander disease and a novel mutation of GFAP. Clin Neurol Neurosurg. 2020;195: 105893. https://doi.org/10.1016/j.clineuro.2020.105893.

    Article  PubMed  Google Scholar 

  95. Tulyeu J, Tamaura M, Jimbo E, Shimbo H, Takano K, Iai M, et al. Aggregate formation analysis of GFAP(R416W) found in one case of Alexander disease. Brain Dev. 2019;41(2):195–200. https://doi.org/10.1016/j.braindev.2018.08.009.

    Article  PubMed  Google Scholar 

  96. Thyagarajan D, Chataway T, Li R, Gai WP, Brenner M. Dominantly-inherited adult-onset leukodystrophy with palatal tremor caused by a mutation in the glial fibrillary acidic protein gene. Mov Disord. 2004;19(10):1244–8. https://doi.org/10.1002/mds.20161.

    Article  PubMed  Google Scholar 

  97. Suzuki H, Yoshida T, Kitada M, Ichihashi J, Sasayama H, Nishikawa Y, et al. Late-onset Alexander disease with a V87L mutation in glial fibrillary acidic protein (GFAP) and calcifying lesions in the sub-cortex and cortex. J Neurol. 2012;259(3):457–61. https://doi.org/10.1007/s00415-011-6201-z.

    Article  PubMed  Google Scholar 

  98. Yoshida T, Sasayama H, Mizuta I, Okamoto Y, Yoshida M, Riku Y, et al. Glial fibrillary acidic protein mutations in adult-onset Alexander disease: clinical features observed in 12 Japanese patients. Acta Neurol Scand. 2011;124(2):104–8. https://doi.org/10.1111/j.1600-0404.2010.01427.x.

    Article  CAS  PubMed  Google Scholar 

  99. Stumpf E, Masson H, Duquette A, Berthelet F, McNabb J, Lortie A, et al. Adult Alexander disease with autosomal dominant transmission: a distinct entity caused by mutation in the glial fibrillary acid protein gene. Arch Neurol. 2003;60(9):1307–12. https://doi.org/10.1001/archneur.60.9.1307.

    Article  PubMed  Google Scholar 

  100. Stitt DW, Gavrilova R, Watson R, Hassan A. An unusual presentation of late-onset Alexander’s disease with slow orthostatic tremor and a novel GFAP variant. Neurocase. 2018;24(5–6):266–8. https://doi.org/10.1080/13554794.2019.1580749.

    Article  PubMed  Google Scholar 

  101. Sreedharan J, Shaw CE, Jarosz J, Samuel M. Alexander disease with hypothermia, microcoria, and psychiatric and endocrine disturbances. Neurology. 2007;68(16):1322–3. https://doi.org/10.1212/01.wnl.0000259543.95222.9d.

    Article  PubMed  Google Scholar 

  102. Rezende SADS, Fernandes M, Munhoz RP, Raskin S, Schelp AO, Knaap MS, et al. Cerebellar ataxia as the first manifestation of Alexander’s disease. Arq Neuropsiquiatr. 2012;70:309–10.

    Article  Google Scholar 

  103. Okamoto Y, Mitsuyama H, Jonosono M, Hirata K, Arimura K, Osame M, et al. Autosomal dominant palatal myoclonus and spinal cord atrophy. J Neurol Sci. 2002;195(1):71–6. https://doi.org/10.1016/s0022-510x(01)00687-6.

    Article  PubMed  Google Scholar 

  104. Graff-Radford J, Schwartz K, Gavrilova RH, Lachance DH, Kumar N. Neuroimaging and clinical features in type II (late-onset) Alexander disease. Neurology. 2014;82(1):49–56. https://doi.org/10.1212/01.wnl.0000438230.33223.bc.

    Article  PubMed  PubMed Central  Google Scholar 

  105. Delnooz CC, Schelhaas JH, van de Warrenburg BP, de Graaf RJ, Salomons GS. Alexander disease causing hereditary late-onset ataxia with only minimal white matter changes: a report of two sibs. Mov Disord. 2008;23(11):1613–5. https://doi.org/10.1002/mds.22053.

    Article  PubMed  Google Scholar 

  106. Bachetti T, Caroli F, Bocca P, Prigione I, Balbi P, Biancheri R, et al. Mild functional effects of a novel GFAP mutant allele identified in a familial case of adult-onset Alexander disease. Eur J Hum Genet. 2008;16(4):462–70.

    Article  CAS  Google Scholar 

  107. Hayashi Y, Nagasawa M, Asano T, Yoshida T, Kimura A, Inuzuka T. Central hypothermia associated with Alexander disease. A case report. Clin Neurol Neurosurg. 2017;157:31–3.

    Article  Google Scholar 

  108. Nagaishi A, Nakane S, Fukudome T, Matsuo H, Yoshida T. A case of Alexander disease suspected juvenile-onset and exacerbating after long stationary state. Rinsho shinkeigaku Clin Neurol. 2013;53(6):474–7. https://doi.org/10.5692/clinicalneurol.53.474.

    Article  Google Scholar 

  109. Yonezu T, Ito S, Kanai K, Masuda S, Shibuya K, Kuwabara S. A case of adult-onset alexander disease featuring severe atrophy of the medulla oblongata and upper cervical cord on magnetic resonance imaging. Case Rep Neurol. 2012;4(3):202–6. https://doi.org/10.1159/000345303.

    Article  PubMed  PubMed Central  Google Scholar 

  110. Yoshida T, Mizuta I, Saito K, Kimura Y, Park K, Ito Y, et al. Characteristic abnormal signals in medulla oblongata-"eye spot" sign: four cases of elderly-onset Alexander disease. Neurol Clin Pract. 2015;5(3):259–62. https://doi.org/10.1212/cpj.0000000000000124.

    Article  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

Special acknowledgments to the family that let us to document their story to improve our realization of the condition.

Funding

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Author information

Authors and Affiliations

Authors

Contributions

KH wrote the initial manuscript text. NN and TM performed the wet lab evaluation. HP surveyed the patient clinically. SK contributed to the research design and analyzed WES data. All authors reviewed the manuscript.

Corresponding author

Correspondence to Samira Kalayinia.

Ethics declarations

Ethics approval and consent to participate

This research was provided by the Cardiogenetic Research Center, Rajaie Cardiovascular Medical and Research Center, Iran University of Medical Sciences, Tehran, Iran, approved by RHC Ethics Committee (IR.RHC.REC.1400.077).

Informed consent

Informed consent has been obtained by the authors.

Competing interests

The authors declare that they have no conflict of financial interest.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Heshmatzad, K., Naderi, N., Masoumi, T. et al. Identification of a novel de novo pathogenic variant in GFAP in an Iranian family with Alexander disease by whole-exome sequencing. Eur J Med Res 27, 174 (2022). https://doi.org/10.1186/s40001-022-00799-5

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s40001-022-00799-5

Keywords

  • Infantile Alexander disease
  • GFAP
  • Leukodystrophy
  • Whole-exome sequencing
  • Genetics
  • In silico analysis